Skip to main content

I held the future of data storage in my hands and it couldn't look weirder - 2024 could be the year DNA storage goes mainstream and it couldn't come sooner

This is a hands-on “review” like no other. This is a product that has no equivalent right now and yet is so limited in scope that there’s no real market for it. Don’t underestimate its impact though: DNA storage is the future of data storage and it can’t be otherwise given the current rate of growth of global data production, new use cases like generative AI and how much power is associated with producing and storing bytes.

TechRadar Pro has written extensively about this exciting new medium and I believe that 2024 could be the year when DNA storage reaches maturity with big storage players like Microsoft and Seagate delivering timelines and validating this market. Forget glass, ceramic, silicon, holograms and so many other exotic storage media; DNA is the real deal.

French startup Biomemory became the first company to ship a DNA storage device to the general public. With an initial launch sticker price of of 1,000 Euros and a capacity of 1KB, this is more of a proof of concept. The card I received is already loaded with a read-only message: Citius, Altius, Fortius - Communiter (Faster, Higher, Stronger - Together), the motto of the modern age Olympic games, which will be held in 2024 in Paris, France, the home city of Biomemory.

The paragraph above is 476 bytes long and would translate into a series of corresponding fundamental building blocks (e.g. AGACAGTCAGTGACTCAGTC). After purchasing the card, you can send your text and you can test the retrieval of your data using a free sequencing process provided by Eurofins Genomics. This is a destructive process so one DNA card will be lost which is why two copies are provided.

The medium I received was a brushed metal slab the size of a credit card with the Biomemory logo stamped on the top right end side: the card itself is about 4mm thick and weighs around 30g. The actual DNA storage is a black circle, roughly 8mm in diameter. Other than storing it in a safe place, there’s nothing you can do with it. You can read, copy or write on it. There’s two notches at the back to help with the extraction of the DNA as well as two QR codes and a unique ID. A letter - from Biomemory’s CEO - accompanied the two cards.

biomemory dna storage card

(Image credit: Future)

Future iterations are likely to be very different in capacity, format and speed. By 2026, Biomemory plans to launch a 100PB self-enclosed DNA card with a $150,000 price tag with 1,000PB (one Exabyte) expected to be rolled out by the end of this decade.

The cheapest storage media at the time of writing - LTO tapes - cost about $4 per TB or $400,000 for 100PB, excluding CAPEX/OPEX costs associated with physical storage, power consumption and handling of about 8,000 LTO-8 tapes.

The CEO of the company, Erfane Arwani, quoted write speeds of 3MB per second using a separate reading module. That’s just under 11GB per hour or 96TB per year. It would take 1,000 years to fill the 100PB card although exponential improvements in read/write speeds are likely to cut that by several orders of magnitude. Remember that the actual media will never change (DNA is, after all, immutable) but the interface will evolve the way interfaces and ports have over the past few decades (e.g. MCA to PCI-e or ATA to NVMe).



Comments

Popular posts from this blog

The latest Apple TV 4K test lets you watch four sports streams at once

Apple is trying something new with the latest beta version of tvOS 16.5: the option to watch up to four simultaneous streams at once. Right now it's limited to live sports streamed through the Apple TV app on the Apple TV 4K , specifically MLB Friday Night Baseball and the MLS Season Pass. A multi-view option was spotted in the tvOS software last month, but the code was hidden and not enabled. MacRumors reported that the feature would be enabled this weekend, and beta testers have since been able to use it. As yet multi-view hasn't been officially announced by Apple, but it's expected that tvOS 16.5 is going to be pushed out in its final form within the next month or so. WWDC 2023 is around the corner as well, when we should be hearing about the next major updates for Apple's various operating systems – including tvOS 17. How it works Over at 9to5Mac there's a hands-on demonstrating how the multi-view feature works, and it's pretty much as you would expe...

TechRadar's Year in Review: AI revolution, smartphone evolution, and visions of the future

If I had to sum up 2023 in one word it would be AI. Okay, technically that’s two initials, but let’s not quibble – because there’s no doubt that it provided the year in tech with its main story arc. Artificial intelligence was everywhere this year, as every company in the world gawped at the massive impact of ChatGPT, and decided they wanted to jump aboard that bandwagon. You could barely move for new chatbots, new image generators, and new AI-enhanced features in every device released in 2023. And there’s no sign of that changing in 2024; in fact, we expect it to be an even bigger deal. Elsewhere, phones and laptops did much the same as they had the previous year – well, except where they had new AI-enhanced features – so it was in the virtual reality space where bigger changes were afoot. If the Meta Quest 3 was impressive then the Apple Vision Pro looks to be genuinely game-changing, and we can’t wait to see what impact it has in the next 12 months. Of course we also saw plenty ...

Garmin's new radar-equipped tail light will keep you safe on your e-bike

Garmin's Varia bike radars are some of the most popular pieces of cycling tech around – and now the company has delivered its first rearview radar to have been specially designed for some of the best e-Bikes .   Garmin's Varia range mounts to the back of your bike and broadcasts a radar signal behind you, so you can get visual and audible alerts when something's overtaking you. Even better, the new Varia eRTL615 plugs directly into most e-bikes, with no battery required. Because the catchily-named Varia eRTL615 is also a tail light, it'll also make sure you're visible to other vehicles too, promising to emit a flashing or solid light that's visible from up to a mile away in daylight. To connect Garmin's new radar tail light to your e-bike, you'll need to pick the right Garmin adapter cable (which isn't included). You can buy power cables compatible with Bosch, Shimano, or USB-A terminals or connections, with more info on those available on Garmin...