Skip to main content

I held the future of data storage in my hands and it couldn't look weirder - 2024 could be the year DNA storage goes mainstream and it couldn't come sooner

This is a hands-on “review” like no other. This is a product that has no equivalent right now and yet is so limited in scope that there’s no real market for it. Don’t underestimate its impact though: DNA storage is the future of data storage and it can’t be otherwise given the current rate of growth of global data production, new use cases like generative AI and how much power is associated with producing and storing bytes.

TechRadar Pro has written extensively about this exciting new medium and I believe that 2024 could be the year when DNA storage reaches maturity with big storage players like Microsoft and Seagate delivering timelines and validating this market. Forget glass, ceramic, silicon, holograms and so many other exotic storage media; DNA is the real deal.

French startup Biomemory became the first company to ship a DNA storage device to the general public. With an initial launch sticker price of of 1,000 Euros and a capacity of 1KB, this is more of a proof of concept. The card I received is already loaded with a read-only message: Citius, Altius, Fortius - Communiter (Faster, Higher, Stronger - Together), the motto of the modern age Olympic games, which will be held in 2024 in Paris, France, the home city of Biomemory.

The paragraph above is 476 bytes long and would translate into a series of corresponding fundamental building blocks (e.g. AGACAGTCAGTGACTCAGTC). After purchasing the card, you can send your text and you can test the retrieval of your data using a free sequencing process provided by Eurofins Genomics. This is a destructive process so one DNA card will be lost which is why two copies are provided.

The medium I received was a brushed metal slab the size of a credit card with the Biomemory logo stamped on the top right end side: the card itself is about 4mm thick and weighs around 30g. The actual DNA storage is a black circle, roughly 8mm in diameter. Other than storing it in a safe place, there’s nothing you can do with it. You can read, copy or write on it. There’s two notches at the back to help with the extraction of the DNA as well as two QR codes and a unique ID. A letter - from Biomemory’s CEO - accompanied the two cards.

biomemory dna storage card

(Image credit: Future)

Future iterations are likely to be very different in capacity, format and speed. By 2026, Biomemory plans to launch a 100PB self-enclosed DNA card with a $150,000 price tag with 1,000PB (one Exabyte) expected to be rolled out by the end of this decade.

The cheapest storage media at the time of writing - LTO tapes - cost about $4 per TB or $400,000 for 100PB, excluding CAPEX/OPEX costs associated with physical storage, power consumption and handling of about 8,000 LTO-8 tapes.

The CEO of the company, Erfane Arwani, quoted write speeds of 3MB per second using a separate reading module. That’s just under 11GB per hour or 96TB per year. It would take 1,000 years to fill the 100PB card although exponential improvements in read/write speeds are likely to cut that by several orders of magnitude. Remember that the actual media will never change (DNA is, after all, immutable) but the interface will evolve the way interfaces and ports have over the past few decades (e.g. MCA to PCI-e or ATA to NVMe).



Comments

Post a Comment

Popular posts from this blog

Windows Copilot leak suggests deeper assimilation with Windows 11 features

Key Windows 11 features may soon be customizable as Microsoft further integrates its Windows Copilot AI assistant into the operating system. This tidbit comes from tech news site Windows Latest , which claims to have discovered new .json (JavaScript Object Notation) files within recent preview builds of Windows 11. These files apparently hint at future upgrades for the desktop AI assistant. For example, a “TaskManagerService-ai-plugin.json” was found which is supposedly a “plugin for Task Manager integration”. If this ever comes out, it could give users the ability to “monitor or close running apps using” Copilot. In total, six are currently tested and they affect various aspects of Windows 11. Next, there is an “AccessbilityTools-ai-plugin.json” that gives Copilot a way to “control accessibility [tools]. This would make it "easier for those with [a] disability to navigate through the system.” Third is “ai-plugin-WindowsSettings.json” for controlling important Windows 11 set...
Post a Comment
Read more

Google Chrome releases security fix for this major flaw, so update now

Google says it has fixed a high-severity flaw in its Chrome browser which is currently being exploited by threat actors in the wild.  In a security advisory , the company described the flaw being abused and urged the users to apply the fix immediately.  "Google is aware that an exploit for CVE-2023-2033 exists in the wild," the advisory reads. Automatic updates The zero-day in question is a confusion weakness vulnerability in the Chrome V8 JavaScript engine, the company said. Usually, this type of flaw can be used to crash the browser, but in this case it can also be used to run arbitrary code on compromised endpoints.  The flaw was discovered by Clement Lecigne from the Google Threat Analysis Group (TAG). Usually, TAG works on finding flaws abused by nation-states, or state-sponsored threat actors. There is no word on who the threat actors abusing this flaw are, though. Read more > Patch Google Chrome now to fix this emergency security flaw > Emergency...
Post a Comment
Read more

Samsung's ViewFinity S9 may be the monitor creatives have been searching for

Originally revealed during CES 2023 , Samsung has finally launched its ViewFinity S9 5K monitor after nine long months of waiting.  According to the announcement, the ViewFinity S9 is the company’s first-ever 5K resolution (5,120 x 2880 pixels) IPS display aimed primarily at creatives. IPS stands for in-plane switching , a form of LED tech offering some of the best color output and viewing angles on the market. This quality is highlighted by the fact that the 27-inch screen supports 99 percent of the DCI-P3 color gamut plus delivers 600 nits of brightness.  Altogether, these deliver great picture quality made vibrant by saturated colors and dark shadows. The cherry on top for the ViewFinity S9 is a Matte Display coating to “drastically [reduce] light reflections.”  As a direct rival to the Apple Studio Display , the monitor is an alternative for creative professionals looking for options. It appears Samsung has done its homework as the ViewFinity S9 addresses some of...
Post a Comment
Read more